FastQC Report
Thu 29 Nov 2012
SRR026762.fastq.gz

Summary

Basic Statistics

Measure Value
Filename SRR026762.fastq.gz
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 5677631
Filtered Sequences 0
Sequence length 36
%GC 49

Per base sequence quality

Per sequence quality scores

Per base sequence content

Per base GC content

Per sequence GC content

Per base N content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences

Sequence Count Percentage Possible Source
AGCAGCATTGTACAGGGCTATGATCGTATGCCGTCT 196189 3.455472890013458 No Hit
TACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTG 111053 1.9559742434828893 Illumina PCR Primer Index 1 (96% over 28bp)
TCTACAGTCCGACGATCTCGTATGCCGTCTTCTGCT 96382 1.6975742171338717 RNA PCR Primer, Index 47 (96% over 27bp)
TATTGCACTTGTCCCGGCCTGTTCGTATGCCGTCTT 94587 1.6659589184291828 No Hit
CTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTT 77363 1.3625929547024103 Illumina PCR Primer Index 1 (96% over 27bp)
TTCTACAGTCCGACGATCTCGTATGCCGTCTTCTGC 74860 1.318507666313644 RNA PCR Primer, Index 47 (96% over 26bp)
CATTGCACTTGTCTCGGTCTGATCGTATGCCGTCTT 54305 0.9564728669404545 No Hit
ACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGA 51874 0.9136557130958317 RNA PCR Primer, Index 47 (96% over 29bp)
AGTTCTACAGTCCGACGATCTCGTATGCCGTCTTCT 38000 0.6692932316312913 Illumina PCR Primer Index 1 (95% over 23bp)
AAAGTGCTGCGACATTTGAGCGTTCGTATGCCGTCT 29261 0.5153734013358741 No Hit
CAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGAA 28185 0.49642183509284066 Illumina PCR Primer Index 1 (96% over 28bp)
TCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAA 27982 0.49284640019754716 Illumina Single End Adapter 2 (100% over 21bp)
TATTGCACTCGTCCCGGCCTCCTCGTATGCCGTCTT 23605 0.4157543877014903 No Hit
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 23098 0.4068246069531465 No Hit
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 22347 0.3935972591385386 No Hit
TAGCTTATCAGACTGATGTTGACTCGTATGCCGTCT 21697 0.38214882228168756 No Hit
ACCGGGCGGAAACACCATCGTATGCCGTCTTCTGCT 21646 0.3812505603129192 No Hit
CGACTCTTAGCGGTGGATCACTCGGCTCGTATGCCG 19884 0.35021648994096305 No Hit
AAGTGCTGCGACATTTGAGCGTTCGTATGCCGTCTT 19780 0.3483847400438669 No Hit
ACTGGACTTGGAGTCAGAAGGCTCGTATGCCGTCTT 19167 0.33758798343886737 No Hit
AGCAGCATTGTACAGGGCTATGTCGTATGCCGTCTT 17403 0.30651868710735164 No Hit
AGCTACATTGTCTGCTGGGTTTCTCGTATGCCGTCT 16762 0.2952287670685185 No Hit
TGAGGGGCAGAGAGCGAGACTTTTCGTATGCCGTCT 16554 0.2915652672743262 No Hit
ACAGTAGTCTGCACATTGGTTATCGTATGCCGTCTT 16027 0.282283226930387 No Hit
AGTCCGACGATCTCGTATGCCGTCTTCTGCTTGAAA 15852 0.2792009554689271 RNA PCR Primer, Index 47 (96% over 29bp)
GTTCTACAGTCCGACGATCTCGTATGCCGTCTTCTG 15513 0.27323015532358474 Illumina PCR Primer Index 1 (95% over 24bp)
CGCGACCTCAGATCAGACGTCGTATGCCGTCTTCTG 13443 0.2367712871794592 No Hit
CAGTGCAATGTTAAAAGGGCATTCGTATGCCGTCTT 13178 0.2321038475378199 No Hit
TACCACAGGGTAGAACCACGGACTCGTATGCCGTCT 12393 0.2182776584106998 No Hit
TCGTTTCCGGCTCGAAGGACCATCGTATGCCGTCTT 12377 0.21799585073422348 No Hit
CGCGACCTCAGATCAGACGTTCGTATGCCGTCTTCT 12258 0.21589990614043075 No Hit
GAAGCGGGTGCTCTTATTTTCGTATGCCGTCTTCTG 11728 0.20656502685715222 No Hit
GAAGCGGGTGCTCTTATTTTTCGTATGCCGTCTTCT 11604 0.20438101736446063 No Hit
AATTGCACGGTATCCATCTGTATCGTATGCCGTCTT 11441 0.20151010166035802 No Hit
TCCCGGACGAGCCCCCATCGTATGCCGTCTTCTGCT 11407 0.20091126034784576 No Hit
TATTGCACTTGTCCCGGCCTGTATCGTATGCCGTCT 11352 0.1999425464599584 No Hit
CAAAGTGCTGTTCGTGCAGGTAGTCGTATGCCGTCT 11006 0.1938484554561577 No Hit
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10800 0.19022018162152488 No Hit
AAGGTAGATAGAACAGGTCTTGTCGTATGCCGTCTT 10024 0.17655250931242272 No Hit
AATTGCACGGTATCCATCTGTATTCGTATGCCGTCT 9789 0.1724134590641766 No Hit
ACCGGGCAGAAGCACCATCGTATGCCGTCTTCTGCT 9473 0.166847757453769 No Hit
ACCACAGGGTAGAACCACGGACTCGTATGCCGTCTT 9289 0.16360696917429118 No Hit
TAAACGTGGATGTACTTGCTTTTCGTATGCCGTCTT 9251 0.1629376759426599 No Hit
TGTAAACATCCCCGACTGGAAGCTTCGTATGCCGTC 9179 0.1616695413985164 No Hit
AGCTACATTGTCTGCTGGGTTTTCGTATGCCGTCTT 8964 0.15788275074586566 No Hit
TCACAGTGAACCGGTCTCTTTTCGTATGCCGTCTTC 8958 0.15777707286718703 No Hit
CGACTCTTAGCGGTGGATCGTATGCCGTCTTCTGCT 8719 0.1535675706998218 No Hit
CAACGGAATCCCAAAAGCAGCTGTCGTATGCCGTCT 8628 0.15196478953986267 No Hit
AGCAGCATTGTACAGGGCTATGATTCGTATGCCGTC 8374 0.14749109267580088 No Hit
ACAGTAGTCTGCACATTGGTTTCGTATGCCGTCTTC 8257 0.14543037404156767 No Hit
CGCGACCTCAGATCAGACGTGTCGTATGCCGTCTTC 7990 0.1407277084403689 No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7810 0.13755737208001015 No Hit
ACTGGACTTGGAGTCAGAAGGTCGTATGCCGTCTTC 7692 0.13547904046599718 No Hit
AGCAGCATTGTACAGGGCTATGAATCGTATGCCGTC 7592 0.1337177424880201 No Hit
ACGTTGGGCGCCATCGTATGCCGTCTTCTGCTTGAA 7413 0.13056501910744112 Illumina Paired End PCR Primer 2 (95% over 22bp)
TAAGTGCTTCCATGTTTTAGTAGTCGTATGCCGTCT 7299 0.12855713941254723 No Hit
TCCGGCTCGAAGGACCATCGTATGCCGTCTTCTGCT 7109 0.12521067325439078 No Hit
TCGTTCTACAGTCCGACGATCTCGTATGCCGTCTTC 7103 0.12510499537571215 Illumina PCR Primer Index 1 (95% over 22bp)
AGCAGCATTGTACAGGGCTATTCGTATGCCGTCTTC 7070 0.12452376704297971 No Hit
TAAGTGCTTCCATGTTTTGGTGATCGTATGCCGTCT 6507 0.11460765942696875 No Hit
TAAGTGCTTCCATGTTTGAGTGTTCGTATGCCGTCT 6379 0.11235319801515808 No Hit
ACTCAAACTGTGGGGGCACTTTTCGTATGCCGTCTT 6353 0.11189526054088403 No Hit
ACTGGACTTGGAGTCAGAAGGCATCGTATGCCGTCT 6174 0.10874253716030506 No Hit
TAAACGTGGATGTACTTGCTTTCGTATGCCGTCTTC 6128 0.1079323400904356 No Hit
TAGCTTATCAGACTGATGTTGATCGTATGCCGTCTT 6060 0.10673465746541119 No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6005 0.10576594357752381 No Hit
CTCGTACGACTCTTAGCGGTGGATCGTATGCCGTCT 5963 0.10502619842677342 No Hit
TCCCTGTTCGGGCGCCATCGTATGCCGTCTTCTGCT 5886 0.10366999898373107 No Hit
CGCGACCTCAGATCGTATGCCGTCTTCTGCTTGAAA 5878 0.10352909514549291 Illumina Paired End PCR Primer 2 (95% over 22bp)
CCGGGCGGAAACACCATCGTATGCCGTCTTCTGCTT 5708 0.10053488858293186 Illumina Single End Adapter 2 (95% over 21bp)

Kmer Content

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
AAAAA 5482385 116.73614 186.01672 4
ATGCC 4309220 25.577908 149.81392 27
GTATG 4318515 22.901121 135.3456 25
CGTAT 4357180 21.133427 124.842384 24
TCGTA 4300640 20.859192 123.280754 23
TGCCG 4272855 20.724596 121.17348 28
TATGC 4243525 20.58217 121.66653 26
GCCGT 4152175 20.139261 119.43733 29
CCGTC 4047620 17.956003 108.47112 30
CGTCT 3975420 14.410898 91.52628 31
GTCTT 3273830 9.697555 76.754555 32
GACGA 863535 9.176192 53.72518 9
TACAG 1081980 8.592944 78.92398 11
ACAGT 897905 7.131044 42.550568 2
CGACG 859785 6.8283544 41.019684 8
ATCGT 1405700 6.818001 59.18115 23
CCGAC 919845 6.681638 37.625793 7
TCTTC 2442680 6.617817 29.86282 28
ACGAT 822760 6.534252 39.48933 10
TCTGC 1787640 6.480196 34.92576 31
CTTCT 2324620 6.2979646 30.830967 29
CTGCT 1557330 5.645322 35.311813 32
TTCTG 1900695 5.6301312 30.062672 30
CAGTC 937135 5.5624804 30.455067 3
CTCGT 1522190 5.5179396 22.354729 15
AGTCC 886175 5.260001 30.443693 4
TCCGA 855160 5.0759077 29.841726 6
CGATC 854360 5.0711594 29.488976 11
CTACA 665455 4.833742 37.863365 3
ACAGG 426250 4.5294657 107.23936 12
AGCAG 420430 4.4676204 107.87481 1
GTCCG 869740 4.218493 24.802958 5
GATCT 865360 4.197215 23.75541 12
TCTCG 1144765 4.149774 19.869358 14
GAAAA 231475 4.027555 44.963306 21
GATCG 617585 4.0079384 59.0396 22
ATCTC 887320 3.9362867 22.772915 13
TGCTT 1327335 3.9317567 25.542494 31
CAGGG 442965 3.8463924 86.75445 13
GCTTG 939755 3.7246087 30.760838 32
AGGGC 410825 3.5673115 86.306076 14
AAAAT 270915 3.522983 6.213924 12
TTCGT 1158805 3.4325469 29.966906 22
CAGCA 345675 3.359639 96.628746 3
AAAAC 196370 3.1250327 9.47677 27
TGAAA 287310 3.053021 32.17581 20
AAAAG 173125 3.0122926 24.940535 13
AGCAT 372565 2.9588625 79.01162 4
GCAGC 370105 2.939349 79.591965 2
CTTGA 593180 2.8770733 25.10097 32
AAACA 177660 2.8272817 15.764774 10
TTGAA 415680 2.697615 24.959818 32
TGCAC 448845 2.664175 63.46834 4
GTACA 326165 2.5903597 77.25588 10
GGCTA 387595 2.5153735 64.232574 16
CATCG 422095 2.505397 19.296045 16
CCGGC 415625 2.4670136 43.27955 14
CATTG 506000 2.4542282 54.95951 6
TCAGA 305080 2.4229054 25.71785 8
GTCGT 610670 2.4203188 13.093188 22
AATCG 303945 2.4138913 11.197696 22
TATGA 366225 2.3766696 55.936897 19
TCTAC 528190 2.3431315 20.809662 1
GCACT 385560 2.2885387 58.11663 5
ATGAT 349670 2.2692332 52.68238 20
GGGCT 422535 2.240725 53.686474 15
CCCGG 356375 2.1153247 42.361668 13
TGATC 429885 2.0850508 40.327816 21
CCATC 383665 2.0828624 16.728115 15
CAAAA 127815 2.034048 12.908224 12
AAGAA 115740 2.0138211 6.375323 24
AAAGA 113955 1.9827627 5.415463 2
AAATC 203685 1.9796124 6.0036087 13
GCATT 403765 1.9583625 48.959785 5
ATTGC 397825 1.929552 51.84549 2
GTTCG 486335 1.9275317 23.230728 21
TTGCA 396600 1.9236104 51.793358 3
ACTTG 382485 1.855149 36.967358 7
AGAAG 129830 1.845925 23.394638 16
CGGCC 308225 1.8295224 42.438663 15
AGAAC 136470 1.7746725 10.8723755 12
AGTGC 273000 1.7716867 20.950665 3
TGTAC 363330 1.7622424 47.561646 9
TTGTA 441620 1.7502948 39.104183 8
CAGAA 131555 1.7107571 21.164637 15
GAAGG 145135 1.6862141 18.823446 17
ATTGT 422215 1.6733861 44.07205 7
ACCAT 229860 1.6696606 16.232733 14
GCTAT 343865 1.6678323 48.776787 17
GGATG 233185 1.6545613 13.44871 3
CTATG 339775 1.6479949 45.71024 18
AGCGG 189160 1.6425306 16.502096 9
GCTCG 321520 1.559466 6.2852077 21
ACAAA 97975 1.5591744 6.5764294 24
TCCCG 350275 1.5538858 31.140312 12
ACTCG 258905 1.5367626 13.088728 7
AAGTG 176305 1.5308946 23.705667 2
TAGAA 142100 1.5099869 8.471406 11
GGAAA 105880 1.5054034 13.651397 8
AAAGC 114835 1.4933282 10.3465 14
CAGAC 149000 1.4481412 15.055517 14
CAGAG 134000 1.4239259 11.364405 8
GGATC 218700 1.4192963 10.961531 15
CACCA 159640 1.419085 15.8023205 13
GAGCG 162830 1.4138997 11.080718 18
GGCCT 290925 1.4110714 35.028606 16
CGGCT 290230 1.4077003 5.3572454 23
GTAGA 161855 1.405422 8.029914 10
CACTT 314305 1.394305 33.35551 6
AGGAT 159920 1.3886201 9.278395 6
AAAGT 130635 1.3881572 13.962704 1
GGCGG 194710 1.3815736 8.825871 5
AGATC 171205 1.3596877 14.557922 10
GGGCG 191285 1.3572713 7.537093 4
TAAAA 103170 1.3416243 8.486955 12
AAACG 102650 1.3348731 12.450584 2
CTTGT 450460 1.3343272 22.102337 8
AGTTC 274680 1.3322675 11.389749 4
TTCTA 365040 1.3232594 12.771519 1
TGGAT 247990 1.3150932 8.50545 14
AGAGC 123480 1.3121371 10.024409 11
ACATT 220340 1.3078449 8.5696335 12
TTTCG 441415 1.3075346 7.1451564 21
TCGAA 162920 1.2938893 6.764668 1
CGGAA 121650 1.2926909 10.274643 7
GAAGC 121065 1.2864746 13.852042 1
GACTC 215185 1.2772572 10.610042 2
GCGGA 146655 1.2734475 9.259012 6
CGAAT 159220 1.2645044 11.59591 2
AAGGA 88365 1.256375 10.555499 15
TTGTC 423735 1.2551639 22.25908 9
CGGGC 193210 1.2538841 9.732557 3
AGTCG 192880 1.2517325 8.565212 22
GTCTG 311155 1.2332263 9.816602 17
AGGAC 115880 1.2313771 8.299959 16
GAATG 141060 1.2248546 8.251256 26
ACGGA 114985 1.2218665 8.881112 18
GACGT 187410 1.2162337 9.742705 16
AGAGA 85495 1.2155693 13.455734 9
GGGCA 139555 1.2117962 8.594456 5
GGTAG 170175 1.2074746 6.0914164 9
AAGCA 92755 1.2061974 10.550104 15
GTCCC 270180 1.1985693 31.55706 11
GCGAC 150125 1.1922828 14.86553 2
AGGGA 102400 1.1897084 9.512262 1
GCCTG 244745 1.1870848 27.853853 17
GAGAG 101200 1.1757665 11.971752 10
ATTCG 241840 1.1729852 6.046343 21
TGTCG 294275 1.1663245 7.984553 21
TGGAG 163580 1.1606798 14.448402 9
GATGT 215515 1.1428779 8.703552 4
AGACG 106980 1.136803 15.8646345 15
AGACT 142815 1.1342181 11.423406 10
CAGAT 141505 1.1238142 14.510519 9
TTGGA 210395 1.1157266 12.520701 8
CGGAC 140215 1.1135782 6.2083716 6
GATCA 140045 1.1122191 12.402467 11
GTGCT 280170 1.1104208 10.834927 4
GTGGA 156165 1.1080667 11.183906 13
GCAGA 103700 1.1019485 11.497813 7
CGACT 183975 1.0920062 10.501904 1
ACCAC 122090 1.0852925 7.552586 2
AGAAT 101945 1.0832907 5.2966866 25
AACAC 90715 1.0789522 11.40273 11
TATTG 268845 1.065527 28.693977 1
GAAAC 81675 1.0621116 12.1656065 9
AAGGC 99885 1.0614094 12.758854 18
TGCTG 265635 1.0528132 5.666549 13
GCAGG 121025 1.0508947 11.9019985 16
TATCG 216275 1.0489885 11.627463 21
GTTCT 352705 1.0447628 6.061442 3
GACTG 160580 1.0421152 9.919878 11
CGGAT 159465 1.0348792 5.2133956 2
CACAG 105470 1.0250702 8.62448 3
AATGC 127440 1.0121118 6.5022526 27
TAGGA 116130 1.008382 8.570737 5
ACAGA 76715 0.9976111 7.5434914 11
CGGTC 203625 0.9876407 12.371651 15
ATCAG 124195 0.98634046 12.167352 12
AAAGG 68540 0.97450274 11.934968 14
GGATT 183315 0.97212106 5.8006654 7
CACGG 122105 0.96974987 9.987548 6
AGAGT 111505 0.96822214 10.495978 2
CTCGG 199480 0.9675364 13.009041 13
GCGGT 182410 0.9673297 10.214185 10
GGACT 148645 0.9646607 10.825876 4
CGACA 99195 0.9640829 12.831545 10
GACAT 120935 0.96044993 11.0793 11
ACTGG 147655 0.958236 10.93684 1
AACAG 73610 0.95723337 7.8049016 12
CTGAT 196230 0.9517652 11.895731 19
GGGGG 122305 0.9488289 7.440216 12
CTGTT 319205 0.945531 12.248664 19
CCGGG 145260 0.94270074 9.963228 2
TCGGC 193455 0.93831336 5.0773187 11
CCTGT 258645 0.9375883 19.998255 18
AACCA 78735 0.93646365 10.286276 14
GAATC 117325 0.9317798 5.900702 6
GAGGG 97995 0.9303494 9.701082 2
GCGGG 130915 0.92891324 9.914176 4
CACTC 169990 0.9228514 12.108524 6
GAGTT 173200 0.9184812 12.519267 3
GAACC 94360 0.9170914 8.294467 13
GGAAG 78905 0.9167377 10.040552 18
TGGAA 105390 0.9151242 7.2526484 17
TGCAG 140175 0.909693 7.379948 15
TCGTC 250305 0.9073557 8.073789 9
GGACG 103880 0.90201986 6.0083284 5
ACTGA 113250 0.8994167 11.241465 12
GGGAT 125555 0.89087397 11.011382 2
GGTCT 224390 0.88934344 11.930525 16
GGGGC 124160 0.8809828 8.928556 4
ACCGG 110685 0.87905294 11.467296 1
TCTGA 180345 0.8747189 10.568543 18
AGAGG 75155 0.87316924 6.406447 14
CTGGA 133745 0.86796427 11.552636 2
GGTGG 149625 0.86753696 9.845423 12
GGCAG 99675 0.86550665 8.894878 6
GAACA 66385 0.8632787 8.273307 11
GACAG 81050 0.8612626 7.3127813 10
CAGTG 132490 0.8598197 6.050233 1
CGGCG 132350 0.8589181 5.707151 12
GGAGT 120620 0.85585773 11.88468 10
CCTTC 257610 0.8541081 7.54997 11
GAGTC 131405 0.8527784 10.917054 11
TGTTC 287315 0.85106826 13.539075 20
TGTCT 287010 0.85016483 7.5468693 10
GCTTT 286020 0.8472323 6.5481315 17
GGACC 105395 0.83704007 5.992605 17
ACATC 114720 0.8333049 6.500251 6
GAGAC 78325 0.83230597 9.740181 16
GACCA 85490 0.8308832 7.29055 18
GCTGG 154590 0.8197989 7.5986037 14
GACCT 137465 0.8159405 10.989514 4
CGAAG 76765 0.81572884 8.025408 13
CGACC 112145 0.814607 13.3047085 3
GATGA 93590 0.81266224 7.222866 8
CAAAG 62170 0.80846626 14.496922 1
GTATC 166405 0.8071063 5.3095164 10
AGCGT 122680 0.79615575 8.289088 19
GACTT 163835 0.79464126 8.038614 5
CGGTG 149315 0.7918252 9.749275 11
TTCCG 217905 0.7899057 6.971012 13
GGGGA 83145 0.78936565 9.2681465 1
AAATG 73680 0.78294045 5.162093 1
GCTTC 215710 0.78194886 5.998773 6
TGTCC 215575 0.7814595 18.066301 10
AAGCG 73380 0.7797589 15.491633 2
AACCG 79850 0.7760676 5.361613 9
AGGGG 81565 0.7743655 9.426938 3
ATCCC 141630 0.768889 6.84445 8
AGTAG 87460 0.75943416 10.534782 3
GTAGT 142555 0.7559704 6.5310626 4
TGATG 142185 0.75400823 7.536668 14
TCAAA 77265 0.75093776 7.897276 3
GAATT 115665 0.75062454 7.9545555 3
TCGGT 189305 0.7502881 10.035376 14
TGGAC 115055 0.7466718 10.864694 3
TGAGC 114920 0.74579567 8.40091 17
AAGGG 64175 0.74560094 9.65973 15
TAAAC 76690 0.7453493 9.258807 1
AACAT 76265 0.74121875 8.725805 5
TAGAG 84920 0.73737884 5.3161964 8
TGAGA 84870 0.73694456 7.4361467 12
TGAGG 103460 0.7340991 9.704583 1
GGAAT 84305 0.7320386 6.812352 5
ACACC 82105 0.7298545 8.576456 12
AGGTA 83600 0.7259169 8.376717 18
AACGT 90775 0.7209232 7.025804 3
CCACA 80730 0.7176317 7.902387 3
AGCTC 120390 0.7145897 6.866651 9
TCTTA 196975 0.71402866 6.5973444 5
CTGGG 134415 0.7128098 7.4476733 15
GTCTC 195290 0.70792633 9.49625 11
TAGCG 108805 0.7061113 12.389535 8
AGTCT 144155 0.69918823 6.0374336 6
CTCGA 117530 0.69761384 6.4298344 11
GTAAA 65625 0.6973461 9.469206 2
TTGAG 131265 0.69609946 9.237618 16
GCACA 71400 0.6939414 12.018574 11
AGGCT 106485 0.6910552 5.5308976 19
GGGTT 159110 0.68947965 6.2929707 17
TCTTT 310955 0.6884047 5.2686267 32
GATGC 105705 0.6859932 5.19771 4
GTGCA 105350 0.6836893 7.2275314 14
ATGTT 172425 0.6833808 6.9125104 12
AGCCC 93775 0.68116975 5.3680806 10
TGTAT 171800 0.6809037 5.0759296 20
ATGTA 104680 0.67933583 8.0015135 5
CAGTA 85390 0.6781562 9.6087675 2
CAGGA 63475 0.6745052 6.678562 12
CTGCA 112805 0.669568 7.4500165 9
AAGTA 62590 0.66509557 5.8463387 4
CCGAA 67935 0.6602649 8.365728 1
TAGTC 135415 0.65679705 6.3037663 21
AACTG 82290 0.65353644 6.7981377 6
CGCGA 81720 0.6490148 14.227445 1
AGGGT 91400 0.64852756 5.933888 7
TACAT 108870 0.64620614 10.194414 4
GATAG 74110 0.6435132 5.239079 7
TGGGT 147945 0.64109766 6.4140563 16
GCTGC 131105 0.63589764 6.415553 6
AAACT 65405 0.6356705 8.00644 5
CTCAG 106245 0.6306303 10.97449 7
GAGAT 72250 0.62736243 6.798879 2
TTTGA 157780 0.6253374 7.2442045 15
CCAAA 52545 0.62496316 8.991344 11
GGCAT 96060 0.6234001 5.2164936 18
ACCTC 114700 0.6226899 9.986475 5
CTGTA 128100 0.62131745 5.633767 18
CGAGT 95560 0.6201552 11.497538 2
GGGTA 87105 0.6180525 5.7899027 8
GCACG 77780 0.6177235 11.088681 5
ATAGA 57695 0.61308014 6.3121862 8
TCCAT 137750 0.61108005 6.9901004 9
AATCC 84100 0.6108868 5.978272 7
GTTGA 115015 0.60992557 11.768597 18
CTTGG 153310 0.6076262 6.9249845 7
GGGTG 104770 0.6074643 7.4399757 6
AGATG 69860 0.6066096 7.9473405 3
CTTAT 166430 0.60330397 5.0138454 4
GGTAT 113480 0.6017855 6.037349 9
CATTC 135555 0.6013426 5.0622816 11
TTGAC 123235 0.5977209 6.789479 19
CGAGA 55940 0.5944358 9.689297 15
CATCT 133755 0.5933576 5.1567273 15
CAAAC 49880 0.59326607 9.676547 4
GCCTC 132095 0.5859983 8.837622 17
ATCAC 80415 0.5841197 8.372288 17
TGCGA 89795 0.5827422 8.229613 8
ACGGT 89575 0.58131444 7.974382 7
CAATG 73195 0.58130515 7.202365 6
CACAT 79970 0.5808873 9.041065 12
TGTAA 89175 0.5787139 5.91488 1
TGTAG 108980 0.5779219 8.36903 6
CGGTA 88700 0.5756359 7.362573 8
TCGTT 193435 0.57298225 5.5193124 1
GCGTT 144390 0.5722728 5.2583404 20
GAGTG 80395 0.5704417 6.881793 3
GGTTT 175920 0.5697434 5.8657556 18
GGTTA 106735 0.5660167 5.4691358 18
ACGAG 53185 0.5651604 5.8134637 7
ACTCT 127125 0.56394595 7.9697366 3
CGTCC 126930 0.5630854 9.730218 10
CCGGA 70700 0.5614947 5.479968 3
AGTCA 70435 0.55938554 12.625851 12
CCGAG 70145 0.5570869 8.814137 1
TAGCT 114385 0.5547962 6.815774 1
GCTAC 93160 0.55296266 10.339062 2
CGGGT 104240 0.5527901 6.6234455 5
CCACG 75760 0.550311 5.901187 16
AATTC 92475 0.5488923 7.1522555 4
ATCCA 75355 0.5473648 8.002557 12
GCTCT 150845 0.5468132 6.0108967 10
GGCAC 68390 0.5431488 6.2185307 15
GTCAG 83245 0.5402346 10.562173 13
GCACC 74280 0.5395605 5.3470845 12
TGACT 110725 0.5370443 5.2144723 20
AAGCT 67475 0.53587765 5.836816 20
CTGCG 110180 0.5344052 6.322047 7
TTAGC 109555 0.5313695 9.529132 7
GCAAT 66390 0.5272607 7.952232 5
AATTG 81195 0.5269265 7.911138 1
AGCTA 66150 0.5253546 13.50641 1
CCATG 88495 0.525273 9.30433 10
TCCGC 117870 0.52289355 8.229768 14
CTTCC 157585 0.5224744 5.2337823 7
GTGGG 89880 0.5211309 5.008711 10
AGCGA 48675 0.51723576 9.60568 13
CTTAG 106455 0.51633376 9.162895 6
AACGG 48495 0.515323 8.298177 2
CAGGT 78790 0.51132303 6.4316072 17
AGCTT 104995 0.5092523 6.715906 2
CAACG 51885 0.5042739 7.332287 1
ATTGG 95030 0.50394493 7.5188084 15
GCGAG 57330 0.49781287 8.192464 14
TTATC 137295 0.49769038 5.0467362 5
ATTTG 124890 0.49498284 6.0533557 14
TTCCA 110030 0.48810986 6.8739643 8
AGATA 45180 0.48009294 6.291283 6
ATAGG 55165 0.47900963 6.9598927 16
CCTCA 87280 0.47383064 9.709412 6
CGTGG 88270 0.46810043 5.044898 5
CCGCT 105385 0.4675077 5.2964478 15
CCTCC 111035 0.45051777 5.971811 18
TATCA 75345 0.4472159 8.252936 6
CATGT 92145 0.44692656 7.2611194 11
CATAT 73915 0.4387281 5.9377346 2
CCTGC 98595 0.437386 5.6538444 14
ACTGT 90105 0.43703207 5.205392 7
ACGTG 67195 0.43607506 5.8080435 4
ATCTG 89805 0.43557698 5.4830103 16
ACTTC 96935 0.43001842 5.0105023 11
TAAGT 65535 0.4252987 9.406771 1
TGCAA 53175 0.42230886 7.058062 4
AGTAA 38140 0.40528432 5.789912 5
TCATA 65525 0.38892862 5.367999 1
GGTGC 73000 0.3871228 6.5450892 7
CATCC 70380 0.38208294 5.1077223 7
ACCTT 85980 0.38142043 5.1469545 10
CCTAC 69405 0.3767898 5.8224244 8
GCTTA 77005 0.37349373 6.767987 3
CTCAA 51365 0.37310585 6.2425203 2
TCACT 82860 0.36757964 5.3037405 18
CCCAA 40350 0.3586825 6.6474295 10
TACCA 49120 0.3567986 6.1207175 1
GTAGC 54265 0.35216329 6.406688 7
TCGAG 51355 0.33327827 5.230074 1
ACTCA 44225 0.3212422 5.9483027 1